Stem-loop sequence mmu-mir-6360

AccessionMI0021888 (change log)
Symbol MGI:Mir6360
DescriptionMus musculus miR-6360 stem-loop
Stem-loop
   -  a    -    gg gg  au     a    ua   u g      ca     -ag g g    u 
5'  gc ucug ggag  u  uc  agguu accu  gug u cucagg  gcagg   a u ugca g
    || |||| ||||  |  ||  ||||| ||||  ||| | ||||||  |||||   | | ||||  
3'  cg agac ccuu  g  ag  uucaa ugga  uac g gggucu  cgucc   u g acgu u
   u  a    u    gu aa  au     c    --   u g      -a     gga g g    g 
Get sequence
Deep sequencing
4 reads, 1.28e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 23774864-23774989 [-]
antisense
OTTMUST00000069900 ; Mapre2-004; intron 2
OTTMUST00000069882 ; Mapre2-002; intron 2
OTTMUST00000070499 ; Mapre2-006; intron 2
OTTMUST00000070500 ; Mapre2-007; intron 2
ENSMUST00000155708 ; Mapre2-004; intron 2
ENSMUST00000118826 ; Mapre2-002; intron 2
ENSMUST00000115830 ; Mapre2-006; intron 2
ENSMUST00000149943 ; Mapre2-007; intron 2
ENSMUST00000170802 ; Mapre2-201; intron 2
Database links

Mature sequence mmu-miR-6360

Accession MIMAT0025103
Sequence

31 - 

uaguguugcucaggcagcagga

 - 52

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).