Stem-loop sequence mmu-mir-6399

AccessionMI0021935 (change log)
Symbol MGI:Mir6399
DescriptionMus musculus miR-6399 stem-loop
Stem-loop
   - gu   uua     -      ug  -    -c   ga       
5'  g  agu   ucaga uaccau  uu ugau  cuu  accuuu 
    |  |||   ||||| ||||||  || ||||  |||  ||||| u
3'  c  uca   agucu auggua  aa guug  gaa  uggaga 
   u uc   cgg     u      gu  c    uc   -a       
Get sequence
Deep sequencing
849 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 138163209-138163292 [+]
sense
OTTMUST00000022986 ; Eif4g3-008; intron 3
OTTMUST00000022912 ; Eif4g3-001; intron 15
ENSMUST00000140796 ; Eif4g3-008; intron 3
ENSMUST00000084215 ; Eif4g3-001; intron 15
ENSMUST00000084214 ; Eif4g3-201; intron 16
ENSMUST00000105831 ; Eif4g3-202; intron 17
Database links

Mature sequence mmu-miR-6399

Accession MIMAT0025151
Sequence

55 - 

uugcaaugaugguauucugagg

 - 76

Get sequence
Deep sequencing849 reads, 48 experiments
Evidence experimental; SOLiD [1]
Database links
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).