Stem-loop sequence mmu-mir-6416

AccessionMI0021954 (change log)
Symbol MGI:Mir6416
DescriptionMus musculus miR-6416 stem-loop
Stem-loop
   u    c  a  ----au        -- ug u  u   -     u   aa   u    cuccu 
5'  ccuc gu uc      cugcucuu  c  g gg cug cuuac ggg  gac gcuc     c
    |||| || ||      ||||||||  |  | || ||| ||||| |||  ||| ||||     u
3'  ggag cg ag      gacgagaa  g  u cc gac gagug ucc  uug cgag     c
   -    u  a  gaaaac        ac gu -  -   u     -   ac   -    auccc 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 64249983-64250099 [-]
antisense
OTTMUST00000054173 ; Trpm1-017; intron 4
OTTMUST00000054172 ; Trpm1-016; intron 4
OTTMUST00000054160 ; Trpm1-004; intron 7
OTTMUST00000054159 ; Trpm1-003; intron 26
OTTMUST00000054157 ; Trpm1-001; intron 26
OTTMUST00000054161 ; Trpm1-005; intron 26
ENSMUST00000124597 ; Trpm1-017; intron 4
ENSMUST00000155787 ; Trpm1-016; intron 4
ENSMUST00000107527 ; Trpm1-004; intron 7
ENSMUST00000085222 ; Trpm1-003; intron 26
ENSMUST00000107525 ; Trpm1-001; intron 26
ENSMUST00000107519 ; Trpm1-005; intron 26
Database links

Mature sequence mmu-miR-6416-5p

Accession MIMAT0025170
Sequence

3 - 

cuccguaucaucugcucuucu

 - 23

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence mmu-miR-6416-3p

Accession MIMAT0025171
Sequence

91 - 

gcaaagagcagcaaaaggaag

 - 111

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).