Stem-loop sequence mmu-mir-6418

AccessionMI0021956 (change log)
Symbol MGI:Mir6418
DescriptionMus musculus miR-6418 stem-loop
Literature search

1 open access papers mention mmu-mir-6418
(1 sentences)

Stem-loop
   a -    -   a    a ---a   c   - --a          a a a    cu   -cu ua 
5'  g ccag aag ggca g    aca ggu c   ggggaaggga g g ugca  guc   c  a
    | |||| ||| |||| |    ||| ||| |   |||||||||| | | ||||  |||   |   
3'  c gguc uuc ccgu c    ugu cca g   ccucuuuccu c c acgu  cag   g  a
   g a    c   g    - guac   -   u gga          - - a    --   ucc ua 
Get sequence
Deep sequencing
380 reads, 1.37 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 137529480-137529594 [-]
sense
OTTMUST00000052084 ; Epo-001; intron 1
OTTMUST00000039058 ; Gnb2-007; exon 2
OTTMUST00000039060 ; Gnb2-010; exon 2
OTTMUST00000092186 ; Gnb2-014; exon 3
OTTMUST00000039059 ; Gnb2-009; exon 3
OTTMUST00000042586 ; Gnb2-012; exon 4
OTTMUST00000092187 ; Gnb2-013; exon 5
OTTMUST00000039056 ; Gnb2-006; exon 5
OTTMUST00000039052 ; Gnb2-002; exon 6
OTTMUST00000042584 ; Gnb2-008; exon 6
OTTMUST00000039054 ; Gnb2-004; exon 6
OTTMUST00000039051 ; Gnb2-001; exon 7
OTTMUST00000042585 ; Gnb2-011; exon 7
OTTMUST00000039055 ; Gnb2-005; exon 7
OTTMUST00000039053 ; Gnb2-003; exon 7
ENSMUST00000111038 ; Epo-001; intron 1
ENSMUST00000144667 ; Gnb2-007; exon 2
ENSMUST00000145238 ; Gnb2-010; exon 2
ENSMUST00000168746 ; Gnb2-014; exon 3
ENSMUST00000125868 ; Gnb2-009; exon 3
ENSMUST00000143495 ; Gnb2-012; exon 4
ENSMUST00000170293 ; Gnb2-013; exon 5
ENSMUST00000142252 ; Gnb2-006; exon 5
ENSMUST00000111023 ; Gnb2-002; exon 6
ENSMUST00000111020 ; Gnb2-008; exon 6
ENSMUST00000150063 ; Gnb2-004; exon 6
ENSMUST00000031726 ; Gnb2-001; exon 7
ENSMUST00000111027 ; Gnb2-011; exon 7
ENSMUST00000132525 ; Gnb2-005; exon 7
ENSMUST00000140139 ; Gnb2-003; exon 7
Database links

Mature sequence mmu-miR-6418-5p

Accession MIMAT0025173
Sequence

24 - 

ucaggggaagggaagagaugc

 - 44

Get sequence
Deep sequencing43 reads, 23 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence mmu-miR-6418-3p

Accession MIMAT0025174
Sequence

65 - 

acugcaaccuccuuucuccagg

 - 86

Get sequence
Deep sequencing319 reads, 65 experiments
Evidence experimental; SOLiD [1]
Database links
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).