Stem-loop sequence ptc-MIR6458

AccessionMI0021963 (change log)
DescriptionPopulus trichocarpa miR6458 stem-loop
Stem-loop
     gg      gc         c   -                     -uucg  cugauuuuucauaaaauugcucu 
5' gg  aaauua  uuaaacacc uau uguuugagcgugaggauacuu     cc                       u
   ||  ||||||  ||||||||| ||| |||||||||||||||||||||     ||                       u
3' uc  uuuaau  aauuugugg aua auaaacucgcacuuuuaugaa     gg                       g
     ua      gc         a   u                     uguaa  aacguucuagaaaacucgcacca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000339.2: 6330962-6331116 [+]
intergenic
Database links

Mature sequence ptc-miR6458

Accession MIMAT0025182
Sequence

119 - 

acgcucaaauauauaagguguu

 - 140

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).