Stem-loop sequence ssc-mir-490-2

AccessionMI0022151 (change log)
DescriptionSus scrofa miR-490-2 stem-loop
Gene family MIPF0000229; mir-490
Literature search

2 open access papers mention ssc-mir-490-2
(2 sentences)

Stem-loop
   cauu        c      -   -      g   cac   u 
5'     guucgaca caugga ucc ccaggu ggu   guu c
       |||||||| |||||| ||| |||||| |||   |||  
3'     cgaguugu guaccu agg ggucca cca   uag a
   uugu        c      c   a      a   -ca   a 
Get sequence
Deep sequencing
73 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-490

Accession MIMAT0025376
Sequence

50 - 

caaccuggaggacuccaugcug

 - 71

Get sequence
Deep sequencing68 reads, 11 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).