Stem-loop sequence pol-mir-124

AccessionMI0022198 (change log)
DescriptionParalichthys olivaceus miR-124 stem-loop
Gene family MIPF0000021; mir-124
Literature search

2 open access papers mention pol-mir-124
(2 sentences)

Stem-loop
   --c        a   ga        uaaug 
5'    guguucac gcg  ccuugauu     u
      |||||||| |||  ||||||||      
3'    cguaagug cgc  ggaauuaa     c
   aac        g   ac        cauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pol-miR-124-5p

Accession MIMAT0025430
Sequence

1 - 

cguguucacagcggaccuugau

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pol-miR-124-3p

Accession MIMAT0025431
Sequence

39 - 

uaaggcacgcggugaaugccaa

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1