Stem-loop sequence pol-mir-221

AccessionMI0022208 (change log)
DescriptionParalichthys olivaceus miR-221 stem-loop
Gene family MIPF0000051; mir-221
Literature search

3 open access papers mention pol-mir-221
(6 sentences)

Stem-loop
   -u     ug   u         auuu     ugu 
5'   gaacc  gca acaauguag    cugug   c
     |||||  ||| |||||||||    |||||    
3'   uuugg  cgu uguuacauc    gacau   a
   ac     gu   c         ----     cug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pol-miR-221-5p

Accession MIMAT0025448
Sequence

4 - 

accuggcauacaauguagauuu

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pol-miR-221-3p

Accession MIMAT0025449
Sequence

42 - 

agcuacauugucugcuggguuu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1