Stem-loop sequence gga-mir-6567

AccessionMI0022384 (change log)
DescriptionGallus gallus miR-6567 stem-loop
Stem-loop
   ccggcuccgcauccagccccggggca      aac     g       ggaa   g 
5'                           gcuccg   ucgcg ugcccgc    ggc c
                             ||||||   ||||| |||||||    ||| u
3'                           cgaggc   ggcgc acgggcg    ccg c
   ----ccuuucccuaccucugcgguuu      -ga     g       ---g   g 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr20: 8632751-8632857 [-]
antisense
ENSGALT00000043825 ; gga-mir-6567-201; 3'UTR (exon 1)
Database links

Mature sequence gga-miR-6567-5p

Accession MIMAT0025639
Sequence

26 - 

agcuccgaacucgcggugcccg

 - 47

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6567-3p

Accession MIMAT0025640
Sequence

68 - 

ggcagcgcggagcggagcuuu

 - 88

Get sequence
Deep sequencing8 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).