Stem-loop sequence gga-mir-6595

AccessionMI0022415 (change log)
DescriptionGallus gallus miR-6595 stem-loop
Stem-loop
   --aau  g a   c     -   u  c  ---u        -          uga  a 
5'      ga u ugg cugag cgu uc ga    gagaugau gaauccuuuc   uc a
        || | ||| ||||| ||| || ||    |||||||| ||||||||||   || a
3'      cu a guc gacuu gcg ag cu    uuuuauua cuuaggaagg   ag g
   gagau  g -   a     u   u  u  uagg        a          -ua  u 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr11: 13466650-13466759 [-]
intergenic
Database links

Mature sequence gga-miR-6595-5p

Accession MIMAT0025689
Sequence

27 - 

ugagaugaugaauccuuucugauca

 - 51

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).