Stem-loop sequence gga-mir-6632

AccessionMI0022451 (change log)
DescriptionGallus gallus miR-6632 stem-loop
Stem-loop
   uaaccu   gg   --c    a      a a    -ug    --ac          ag 
5'       gga  uag   ugaa gagaug g ggag   gaug    agcuggagag  g
         |||  |||   |||| |||||| | ||||   ||||    ||||||||||   
3'       ucu  guc   acuu uucuau c ccuc   cuac    ucgaucucuu  u
   -guuuc   uu   cua    -      g -    uga    aacc          ac 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 45143209-45143318 [+]
sense
ENSGALT00000017688 ; G3BP2-201; intron 6
Database links

Mature sequence gga-miR-6632-5p

Accession MIMAT0025728
Sequence

20 - 

agagaugagaggaguggaugacagc

 - 44

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).