Stem-loop sequence gga-mir-6669

AccessionMI0022489 (change log)
DescriptionGallus gallus miR-6669 stem-loop
Stem-loop
   agucuca   cc    u u  cg     u       gagca        uacuu    c 
5'        ucu  uggg c gc  ccugg gauacgg     aggcugca     gaac u
          |||  |||| | ||  ||||| |||||||     ||||||||     ||||  
3'        aga  gucc g cg  ggacu cuaugcc     uccgacgu     cuug u
   -----gg   uc    u u  ua     -       ---gg        ---uu    a 
Get sequence
Deep sequencing
55 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 27711424-27711531 [-]
intergenic
Database links

Mature sequence gga-miR-6669-5p

Accession MIMAT0025770
Sequence

27 - 

ggugauacgggagcaaggcugcau

 - 50

Get sequence
Deep sequencing8 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6669-3p

Accession MIMAT0025771
Sequence

68 - 

uugcagccuggccguaucucag

 - 89

Get sequence
Deep sequencing47 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).