Stem-loop sequence gga-mir-6557

AccessionMI0022540 (change log)
DescriptionGallus gallus miR-6557 stem-loop
Literature search

1 open access papers mention gga-mir-6557
(1 sentences)

Stem-loop
   ---------cguuacgccccgcg               - --c      ---u   uuu 
5'                        ccgugcccggaggag c   cggcgc    gcc   c
                          ||||||||||||||| |   ||||||    |||   u
3'                        ggcacgggccuccuc g   gccgcg    cgg   a
   gcgucgcccgggcggcuguaggg               u uua      ccgc   cgc 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-6557-5p

Accession MIMAT0025828
Sequence

21 - 

ccggaggagcccggcgcugc

 - 40

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6557-3p

Accession MIMAT0025829
Sequence

57 - 

cgcgccgauugucuccuccgggcac

 - 81

Get sequence
Deep sequencing12 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).