Stem-loop sequence ccr-mir-142-1

AccessionMI0023327 (change log)
DescriptionCyprinus carpio miR-142-1 stem-loop
Gene family MIPF0000084; mir-142
Literature search

1 open access papers mention ccr-mir-142-1
(1 sentences)

Stem-loop
       g  cau       g   cu          ac        uaaag  c 
5' gcgg aa   cagugca uca  cauaaaguag  agcacuac     gu u
   |||| ||   ||||||| |||  ||||||||||  ||||||||     ||  
3' cguc uu   gucaugu agu  guauuucauc  uugugaug     ca c
       g  --u       g   ag          cu        ugaca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-142-5p

Accession MIMAT0026222
Sequence

24 - 

cauaaaguagacagcacuacu

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ccr-miR-142-3p

Accession MIMAT0026223
Sequence

62 - 

guaguguuuccuacuuuaugg

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).