Stem-loop sequence ccr-mir-143

AccessionMI0023329 (change log)
DescriptionCyprinus carpio miR-143 stem-loop
Gene family MIPF0000094; mir-143
Literature search

3 open access papers mention ccr-mir-143
(10 sentences)

Stem-loop
   -     - agg   a  g         g      u  -  aa 
5'  guccu c   ccc ag ugcagugcu caucuc gg uc  c
    ||||| |   ||| || ||||||||| |||||| || ||   
3'  cggga g   ggg uc augucacga guagag cu ag  u
   a     a -ga   c  g         a      u  g  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-143

Accession MIMAT0026224
Sequence

49 - 

ugagaugaagcacuguagcu

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).