Stem-loop sequence ccr-mir-200a

AccessionMI0023361 (change log)
DescriptionCyprinus carpio miR-200a stem-loop
Gene family MIPF0000019; mir-8
Literature search

1 open access papers mention ccr-mir-200a
(4 sentences)

Stem-loop
   cu  -          u    -             c    cugugu 
5'   gg cacuuagcag cauc uuaccggacagug ugga      a
     || |||||||||| |||| ||||||||||||| ||||       
3'   cc guggguuguu guag aauggucugucac aucu      u
   -u  a          u    c             a    uuuguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-200a

Accession MIMAT0026258
Sequence

54 - 

uaacacugucugguaacgaug

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).