Stem-loop sequence ccr-mir-363

AccessionMI0023393 (change log)
DescriptionCyprinus carpio miR-363 stem-loop
Gene family MIPF0000138; mir-363
Literature search

1 open access papers mention ccr-mir-363
(1 sentences)

Stem-loop
   --uuu          a  cc        aauag   c  a 
5'      cggguggaug cc  gcaauuuu     ugg aa a
        |||||||||| ||  ||||||||     ||| || a
3'      gucuaccuau gg  cguuaaaa     acc uu u
   cuaau          -  ca        --aca   -  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-363

Accession MIMAT0026293
Sequence

53 - 

aauugcacgguauccaucugua

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).