Stem-loop sequence ccr-mir-92b

AccessionMI0023420 (change log)
DescriptionCyprinus carpio miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention ccr-mir-92b
(1 sentences)

Stem-loop
         uuguag   -  c    u  c    g       uu     c     uucaa 
5' gugugu      ucc cg gguc gg aggu ugggaug  gugca uguug     u
   ||||||      ||| || |||| || |||| |||||||  ||||| |||||     c
3' cgcaca      agg gc ccag cc uccg gcccugc  cacgu auaac     u
         ------   a  a    u  c    -       -u     u     cgccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccr-miR-92b

Accession MIMAT0026324
Sequence

68 - 

uauugcacucgucccggccucc

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).