Stem-loop sequence bma-mir-5873

AccessionMI0023480 (change log)
Previous IDsbma-mir-5873-1
DescriptionBrugia malayi miR-5873 stem-loop
Stem-loop
   auag       a         c   ---uuga   au 
5'     auagcau gauguuguu uga       cug  a
       ||||||| ||||||||| |||       |||   
3'     uauugua uuguaauga acu       gac  g
   gagg       a         a   ucggaug   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This microRNA was experimentally validated from deep sequencing libraries in the closely related species Brugia pahangi [1].

Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold21: 169704-169776 [-]
intergenic
Database links

Mature sequence bma-miR-5873

Accession MIMAT0026372
Sequence

11 - 

uagauguuguucugauugac

 - 30

Get sequence
Evidence not experimental

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).