Stem-loop sequence bma-mir-5880a

AccessionMI0023491 (change log)
DescriptionBrugia malayi miR-5880a stem-loop
Gene family MIPF0001483; mir-5880
Stem-loop
   ga                     a       c   u   a 
5'   uguccaaguuugaucuaacaa uuaccga gug gca a
     ||||||||||||||||||||| ||||||| ||| ||| a
3'   acagguucaaacuggauuguu aauggcu cau ugu a
   gc                     c       a   -   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This microRNA was experimentally validated from deep sequencing libraries in the closely related species Brugia pahangi [1].

Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold24: 278001-278082 [+]
intergenic
Clustered miRNAs
< 10kb from bma-mir-5880a
bma-mir-5880bBmal_v3_scaffold24: 278000-278080 [-]
bma-mir-5880aBmal_v3_scaffold24: 278001-278082 [+]
Database links

Mature sequence bma-miR-5880a

Accession MIMAT0026380
Sequence

49 - 

acaucgguaacuuguuaggucaaa

 - 72

Get sequence
Evidence not experimental

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).