Stem-loop sequence sbi-MIR6232a

AccessionMI0023535 (change log)
DescriptionSorghum bicolor miR6232a stem-loop
Stem-loop
       -au      cu  ua                                           g                   c   u 
5' guag   acauag  uu  cucuguuccgaauuauaagucgcuuugacuuuuuugguacauc auuuugcuauguaucuaga aug u
   ||||   ||||||  ||  ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||  
3' cguu   uguauc  ga  gaggcaagguuuaauauucggcgaaacugaaaaaaccauguag ugaaacgauacauagaucu uau g
       gcu      au  gg                                           g                   a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 206794-206968 [-]
intergenic
Database links

Mature sequence sbi-miR6232a-5p

Accession MIMAT0026444
Sequence

37 - 

gucgcuuugacuuuuuugguacau

 - 60

Get sequence
Evidence not experimental

Mature sequence sbi-miR6232a-3p

Accession MIMAT0026445
Sequence

112 - 

uggauguaccaaaaaagucaaagc

 - 135

Get sequence
Evidence not experimental

References

1
PMID:22747909 "Computational identification and analysis of novel sugarcane microRNAs" Thiebaut F, Grativol C, Carnavale-Bottino M, Rojas CA, Tanurdzic M, Farinelli L, Martienssen RA, Hemerly AS, Ferreira PC BMC Genomics. 13:290(2012).