Stem-loop sequence mdo-mir-191

AccessionMI0005341 (change log)
DescriptionMonodelphis domestica miR-191 stem-loop
Gene family MIPF0000194; mir-191
Stem-loop
         c          c  aa       uu  -  c 
5' agcggg aacggaaucc aa  gcagcug  gu cu c
   |||||| |||||||||| ||  |||||||  || ||  
3' ucgucc uugcuuuagg uu  cgucgac  ua ga a
         c          -  aa       cu  c  g 
Get sequence
Deep sequencing
37496 reads, 480 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 201970817-201970890 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-191
mdo-mir-191chr6: 201970817-201970890 [-]
mdo-mir-425chr6: 201968551-201968635 [-]
mdo-mir-2970chr6: 201968080-201968138 [-]
Database links

Mature sequence mdo-miR-191-5p

Accession MIMAT0004152
Sequence

7 - 

caacggaaucccaaaagcagcu

 - 28

Get sequence
Deep sequencing37206 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1], Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-191-3p

Accession MIMAT0026696
Sequence

49 - 

gcugcaauuggauuucguuccc

 - 70

Get sequence
Deep sequencing290 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).