Stem-loop sequence mtr-MIR171e

AccessionMI0005620 (change log)
DescriptionMedicago truncatula miR171e stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

8 open access papers mention mtr-MIR171e
(54 sentences)

Stem-loop
       c          a         c  a  -  -ga      ugua 
5' aaag gauguuggug gguucaauc ga ga cg   uuuaca    u
   |||| |||||||||| ||||||||| || || ||   ||||||     
3' uuuc cuauaaccgc ccgaguuag cu cu gc   aaaugu    a
       a          g         a  -  a  aua      ugag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 39704652-39704744 [+]
intergenic
Database links

Mature sequence mtr-miR171e-5p

Accession MIMAT0026731
Sequence

5 - 

cgauguuggugagguucaauc

 - 25

Get sequence
Evidence experimental; Illumina [3]

Mature sequence mtr-miR171e-3p

Accession MIMAT0011106
Sequence

68 - 

agauugagccgcgccaauauc

 - 88

Get sequence
Evidence experimental; Illumina [2-3]

References

1
" Bonnet E Unpublished (2007).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
3
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).