Stem-loop sequence tgu-mir-221

AccessionMI0013710 (change log)
DescriptionTaeniopygia guttata miR-221 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
   -------------   ug   u         auuu    -   u 
5'              acc  gca acaauguag    cugu guu g
                |||  ||| |||||||||    |||| ||| u
3'              ugg  cgu uguuacauc    gaca cga u
   guccgucgaccuu   gu   c         ----    a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr1: 5261236-5261308 [+]
sense
ENSTGUT00000018545 ; tgu-mir-221-201; exon 1
Clustered miRNAs
< 10kb from tgu-mir-221
tgu-mir-222-1chr1: 5260725-5260798 [+]
tgu-mir-221chr1: 5261236-5261308 [+]
Database links

Mature sequence tgu-miR-221-5p

Accession MIMAT0026976
Sequence

1 - 

accuggcauacaauguagauuucugu

 - 26

Get sequence
Evidence experimental; Illumina [2]

Mature sequence tgu-miR-221-3p

Accession MIMAT0014512
Sequence

41 - 

agcuacauugucugcuggguuuc

 - 63

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).