Stem-loop sequence pgi-MIR6136b

AccessionMI0021305 (change log)
DescriptionPanax ginseng miR6136b stem-loop
Gene family MIPF0001741; MIR6136
Literature search

1 open access papers mention pgi-MIR6136b
(14 sentences)

Stem-loop
        c               aacc  c            -                     c           u     gacaa 
5' cuuau uuacucacccgugcu    uc cuuuaggcgacg uuucggucauacaaccgucgu uauacuuuuag cgacg     c
   ||||| |||||||||||||||    || |||||||||||| ||||||||||||||||||||| ||||||||||| |||||      
3' gaaua aaugagugggcacga    ag gaaaucugcugc aaagccaguauguugguagua auaugaaaauc gcugc     a
        a               --gu  a            c                     a           -     gauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pgi-miR6136b

Accession MIMAT0027255
Sequence

47 - 

ucauacaaccgucgucuauac

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1