Stem-loop sequence ppe-MIR6297b

AccessionMI0021673 (change log)
DescriptionPrunus persica miR6297b stem-loop
Gene family MIPF0001754; MIR6297
Stem-loop
   gc              a       -au   uuu       g   aauu    gc 
5'   gcaaagucacuuug gcgacga   uau   ucgucgc caa    gguc  g
     |||||||||||||| |||||||   |||   ||||||| |||    ||||   
3'   cguuuuagugaaac cgcugcu   aug   agcagcg guu    ucag  c
   ca              g       guu   --u       a   ----    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG8: 2802745-2802847 [-]
intergenic
Database links

Mature sequence ppe-miR6297b

Accession MIMAT0027336
Sequence

71 - 

gauguauugucgucgcgcaaagu

 - 93

Get sequence
Evidence experimental; Illumina [1]

References

1