Stem-loop sequence mmu-mir-6904

AccessionMI0022751 (change log)
Symbol MGI:Mir6904
DescriptionMus musculus miR-6904 stem-loop
Stem-loop
   uc   uc       u    u g  u  u  uag 
5'   cuu  cuggggu agag u ag gg cg   c
     |||  ||||||| |||| | || || ||    
3'   gaa  gacccca ucuc a uc uc gu   c
   cc   ca       u    u g  u  -  ugu 
Get sequence
Deep sequencing
80 reads, 8.57 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 180587201-180587267 [+]
sense
ENSMUST00000027777 ; Parp1-201; 3'UTR (exon 9)
Database links

Mature sequence mmu-miR-6904-5p

Accession MIMAT0027708
Sequence

6 - 

uccugggguuagaguugagugg

 - 27

Get sequence
Deep sequencing60 reads, 29 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6904-3p

Accession MIMAT0027709
Sequence

43 - 

ucugaucucuuaccccag

 - 60

Get sequence
Deep sequencing20 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).