Stem-loop sequence mmu-mir-6945

AccessionMI0022792 (change log)
Symbol MGI:Mir6945
DescriptionMus musculus miR-6945 stem-loop
Stem-loop
   cacgucc            ccccu   gccca         
5'        ugggaggggcag     ggu     cagaacca 
          ||||||||||||     |||     ||||||| g
3'        acccuucccguc     ucg     gucuugga 
   ----gau            -----   ----a         
Get sequence
Deep sequencing
269 reads, 2.94 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 55507625-55507692 [-]
sense
OTTMUST00000082037 ; Pdlim7-011; intron 3
OTTMUST00000082031 ; Pdlim7-005; intron 4
OTTMUST00000082030 ; Pdlim7-004; intron 5
OTTMUST00000082032 ; Pdlim7-006; intron 5
OTTMUST00000082027 ; Pdlim7-001; intron 5
OTTMUST00000082028 ; Pdlim7-002; intron 5
OTTMUST00000082029 ; Pdlim7-003; intron 5
OTTMUST00000082033 ; Pdlim7-007; 3'UTR (exon 5)
ENSMUST00000128911 ; Pdlim7-011; intron 3
ENSMUST00000128910 ; Pdlim7-005; intron 4
ENSMUST00000155098 ; Pdlim7-004; intron 5
ENSMUST00000153230 ; Pdlim7-006; intron 5
ENSMUST00000046246 ; Pdlim7-001; intron 5
ENSMUST00000069968 ; Pdlim7-002; intron 5
ENSMUST00000069929 ; Pdlim7-003; intron 5
ENSMUST00000131306 ; Pdlim7-007; 3'UTR (exon 5)
Database links

Mature sequence mmu-miR-6945-5p

Accession MIMAT0027790
Sequence

5 - 

uccugggaggggcagccccugg

 - 26

Get sequence
Deep sequencing8 reads, 5 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6945-3p

Accession MIMAT0027791
Sequence

46 - 

ucugagcucugcccuucccau

 - 66

Get sequence
Deep sequencing260 reads, 33 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).