Stem-loop sequence mmu-mir-6949

AccessionMI0022796 (change log)
Symbol MGI:Mir6949
DescriptionMus musculus miR-6949 stem-loop
Stem-loop
   gggagaaa      cu         u   --aag   a 
5'         gugggu  agaaagagg gaa     agu u
           ||||||  ||||||||| |||     |||  
3'         caccua  ucuuuuucc cuu     uca u
   ------ga      --         c   caaaa   u 
Get sequence
Deep sequencing
142 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 56082401-56082468 [-]
sense
ENSMUST00000015594 ; Mcpt8-201; intron 4
Database links

Mature sequence mmu-miR-6949-5p

Accession MIMAT0027798
Sequence

6 - 

aaagugggucuagaaagagguga

 - 28

Get sequence
Deep sequencing129 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-6949-3p

Accession MIMAT0027799
Sequence

48 - 

uuccccuuuuucuauccacag

 - 68

Get sequence
Deep sequencing13 reads, 5 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).