Stem-loop sequence mmu-mir-6967-1

AccessionMI0022815 (change log)
Previous IDsmmu-mir-6967
DescriptionMus musculus miR-6967-1 stem-loop
Gene family MIPF0002025; mir-6967
Literature search

1 open access papers mention mmu-mir-6967-1
(1 sentences)

Stem-loop
   aaaggca              cc   ca u 
5'        gggagggauaaaga  agu  c a
          ||||||||||||||  |||  |  
3'        cccucucuauuucu  uca  g u
   ----gac              ac   aa g 
Get sequence
Deep sequencing
258 reads, 0 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 26920962-26921019 [+]
sense
ENSMUST00000078961 ; Kifc5b-201; intron 2
Database links

Mature sequence mmu-miR-6967-5p

Accession MIMAT0027836
Sequence

6 - 

cagggagggauaaagaccagu

 - 26

Get sequence
Deep sequencing292 reads, 45 experiments
Evidence experimental; meta-analysis [1]

Mature sequence mmu-miR-6967-3p

Accession MIMAT0027837
Sequence

39 - 

ucaucuuuaucucuccccag

 - 58

Get sequence
Deep sequencing220 reads, 47 experiments
Evidence experimental; meta-analysis [1]

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).