Stem-loop sequence mmu-mir-7030

AccessionMI0022879 (change log)
Symbol MGI:Mir7030
DescriptionMus musculus miR-7030 stem-loop
Stem-loop
   uauc             --u  ---   ag     
5'     cuggggagguggc   gu   gcu  ucca 
       |||||||||||||   ||   |||  ||| c
3'     gaccucucuauug   cg   cga  gggg 
   ----             ucu  uuc   cu     
Get sequence
Deep sequencing
79 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 115645573-115645632 [+]
sense
OTTMUST00000034877 ; Rab35-001; intron 5
OTTMUST00000034885 ; Rab35-002; intron 5
ENSMUST00000138885 ; Rab35-002; intron 5
ENSMUST00000031492 ; Rab35-001; intron 5
Database links

Mature sequence mmu-miR-7030-5p

Accession MIMAT0027964
Sequence

6 - 

uggggagguggcugugcuaguc

 - 27

Get sequence
Deep sequencing40 reads, 23 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7030-3p

Accession MIMAT0027965
Sequence

40 - 

cuugcucuguuaucucuccag

 - 60

Get sequence
Deep sequencing39 reads, 27 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).