Stem-loop sequence mmu-mir-7032

AccessionMI0022881 (change log)
Symbol MGI:Mir7032
DescriptionMus musculus miR-7032 stem-loop
Stem-loop
   cguggcc         cc            u    aca   g 
5'        caggguggu  ccgagagggugg cccc   ugg c
          |||||||||  |||||||||||| ||||   ||| a
3'        gucccgcca  ggcucuccuacc gggg   acc a
   ----gac         -u            u    ---   a 
Get sequence
Deep sequencing
64 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 123996852-123996930 [+]
sense
OTTMUST00000092105 ; Hip1r-003; intron 6
OTTMUST00000092103 ; Hip1r-001; intron 13
ENSMUST00000166258 ; Hip1r-003; intron 6
ENSMUST00000000939 ; Hip1r-001; intron 13
Database links

Mature sequence mmu-miR-7032-5p

Accession MIMAT0027968
Sequence

6 - 

cccagggugguccccgagaggguggu

 - 31

Get sequence
Deep sequencing9 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7032-3p

Accession MIMAT0027969
Sequence

57 - 

auccucucgguaccgcccugca

 - 78

Get sequence
Deep sequencing55 reads, 23 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).