Stem-loop sequence mmu-mir-7045

AccessionMI0022894 (change log)
Symbol MGI:Mir7045
DescriptionMus musculus miR-7045 stem-loop
Stem-loop
   gaaagagcgg             -acu   c  c 
5'           gugggggaggggg    gcg gu a
             |||||||||||||    ||| || c
3'           cgcccccuccccc    ugu ca u
   ------gaca             cucu   -  c 
Get sequence
Deep sequencing
57 reads, 3.33 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 125097024-125097086 [+]
sense
OTTMUST00000058440 ; Chd4-002; intron 1
OTTMUST00000058439 ; Chd4-001; intron 1
OTTMUST00000058441 ; Chd4-003; intron 1
OTTMUST00000058443 ; Chd4-005; intron 1
OTTMUST00000058442 ; Chd4-004; 3'UTR (exon 1)
ENSMUST00000112392 ; Chd4-002; intron 1
ENSMUST00000056889 ; Chd4-001; intron 1
ENSMUST00000112390 ; Chd4-003; intron 1
ENSMUST00000155932 ; Chd4-005; intron 1
ENSMUST00000155261 ; Chd4-004; 3'UTR (exon 1)
Database links

Mature sequence mmu-miR-7045-5p

Accession MIMAT0027994
Sequence

6 - 

agcgggugggggagggggacu

 - 26

Get sequence
Deep sequencing38 reads, 27 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7045-3p

Accession MIMAT0027995
Sequence

43 - 

ucuccccccucccccgcacag

 - 63

Get sequence
Deep sequencing19 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).