Stem-loop sequence mmu-mir-7067

AccessionMI0022916 (change log)
Symbol MGI:Mir7067
DescriptionMus musculus miR-7067 stem-loop
Stem-loop
   aggg   ca     u  uu   ca   aca   u 
5'     cug  ggggg gg  gca  cgg   guc c
       |||  ||||| ||  |||  |||   |||  
3'     gac  cccuc cc  cgu  guc   cag u
   ----   ac     -  uu   ua   --a   g 
Get sequence
Deep sequencing
34 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 70895508-70895570 [-]
sense
ENSMUST00000054220 ; Rpl18a-201; intron 4
Database links

Mature sequence mmu-miR-7067-5p

Accession MIMAT0028038
Sequence

6 - 

ugcagggggugguugcacacgga

 - 28

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7067-3p

Accession MIMAT0028039
Sequence

43 - 

ugauugcuucccuccccacag

 - 63

Get sequence
Deep sequencing26 reads, 19 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).