Stem-loop sequence mmu-mir-7072

AccessionMI0022922 (change log)
Symbol MGI:Mir7072
DescriptionMus musculus miR-7072 stem-loop
Stem-loop
   aa    ag      caa     a    accc 
5'   uggg  gggaga   gaggc aggc    u
     ||||  ||||||   ||||| ||||     
3'   accc  ucuucu   cuucg uccg    a
   -g    cu      ---     a    aguc 
Get sequence
Deep sequencing
92 reads, 18.2 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 94505046-94505105 [+]
sense
OTTMUST00000113572 ; Nlrc5-004; intron 23
OTTMUST00000113571 ; Nlrc5-003; intron 26
ENSMUST00000182409 ; Nlrc5-004; intron 23
ENSMUST00000053085 ; Nlrc5-003; intron 26
Database links

Mature sequence mmu-miR-7072-5p

Accession MIMAT0028050
Sequence

6 - 

gaggggagacaagaggcaaggc

 - 27

Get sequence
Deep sequencing85 reads, 30 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7072-3p

Accession MIMAT0028051
Sequence

40 - 

cuagcuucucuucuuccccag

 - 60

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).