Stem-loop sequence mmu-mir-7075

AccessionMI0022925 (change log)
Symbol MGI:Mir7075
DescriptionMus musculus miR-7075 stem-loop
Stem-loop
   ggccgc                  ---  g g    --au   u 
5'       ggggaggaggacaugguu   uu g gggc    gac u
         ||||||||||||||||||   || | ||||    ||| g
3'       cccuuucuucuguaccaa   ag c cucg    cug g
   ----ga                  ccg  g g    gggc   g 
Get sequence
Deep sequencing
212 reads, 3.33 reads per million, 60 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 107096025-107096106 [-]
sense
OTTMUST00000081635 ; Terf2-001; intron 1
OTTMUST00000081666 ; Terf2-004; intron 1
OTTMUST00000081665 ; Terf2-003; intron 1
OTTMUST00000081664 ; Terf2-002; intron 1
ENSMUST00000133925 ; Terf2-001; intron 1
ENSMUST00000142616 ; Terf2-004; intron 1
ENSMUST00000068388 ; Terf2-003; intron 1
ENSMUST00000116425 ; Terf2-002; intron 1
ENSMUST00000068421 ; Terf2-201; intron 1
Database links

Mature sequence mmu-miR-7075-5p

Accession MIMAT0028056
Sequence

6 - 

cggggaggaggacaugguuuu

 - 26

Get sequence
Deep sequencing96 reads, 34 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7075-3p

Accession MIMAT0028057
Sequence

62 - 

caaccaugucuucuuucccag

 - 82

Get sequence
Deep sequencing107 reads, 50 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).