Stem-loop sequence mmu-mir-7076

AccessionMI0022926 (change log)
Symbol MGI:Mir7076
DescriptionMus musculus miR-7076 stem-loop
Stem-loop
   uuucca       ug  au   -c   gc gg   -   g 
5'       ggggagg  gu  ggu  uca  g  guc cgg u
         |||||||  ||  |||  |||  |  ||| ||| u
3'       ccccucu  ca  cca  agu  c  cag guc g
   ----ga       gu  --   uc   -a aa   u   g 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 111689601-111689674 [-]
sense
ENSMUST00000034435 ; Ctrb1-201; intron 1
Database links

Mature sequence mmu-miR-7076-5p

Accession MIMAT0028058
Sequence

6 - 

aggggaggugguauggucuca

 - 26

Get sequence
Deep sequencing15 reads, 3 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7076-3p

Accession MIMAT0028059
Sequence

54 - 

ugacuaccacugucuccccag

 - 74

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).