Stem-loop sequence mmu-mir-7081

AccessionMI0022931 (change log)
Symbol MGI:Mir7081
DescriptionMus musculus miR-7081 stem-loop
Literature search

1 open access papers mention mmu-mir-7081
(1 sentences)

Stem-loop
   auuuca            cggcc     u   aaau  gu 
5'       gaggagggugcu     gggga uau    cu  g
         ||||||||||||     ||||| |||    ||  g
3'       cuccuccuaugg     ccccu aug    ga  u
   --gaca            ----u     u   --au  aa 
Get sequence
Deep sequencing
119 reads, 0 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 20914090-20914164 [-]
sense
ENSMUST00000004202 ; Dnmt1-201; intron 28
ENSMUST00000177754 ; Dnmt1-202; intron 28
ENSMUST00000178110 ; Dnmt1-203; intron 28
Database links

Mature sequence mmu-miR-7081-5p

Accession MIMAT0028068
Sequence

6 - 

agaggagggugcucggccggggauua

 - 31

Get sequence
Deep sequencing10 reads, 9 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence mmu-miR-7081-3p

Accession MIMAT0028069
Sequence

53 - 

uuccccugguauccuccucaca

 - 74

Get sequence
Deep sequencing103 reads, 36 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).