Stem-loop sequence dev-mir-D5

AccessionMI0023584 (change log)
DescriptionDuck enteritis virus miR-D5 stem-loop
Stem-loop
       -aug         a  u     u  -u  u 
5' cgac    ucaucugcg cg ccugc cg  ug u
   ||||    ||||||||| || ||||| ||  ||  
3' gcug    aguggacgc gc ggaug gc  ac a
       gaua         g  -     c  uu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D5-5p

Accession MIMAT0028174
Sequence

6 - 

ugucaucugcgacguccugcucg

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).