Stem-loop sequence dev-mir-D15

AccessionMI0023594 (change log)
DescriptionDuck enteritis virus miR-D15 stem-loop
Stem-loop
      a           a     gau   augu 
5' cug ugguaucuugc uaugc   cgc    a
   ||| ||||||||||| |||||   |||    u
3' gac accauggaacg gugcg   gcg    a
      g           g     agc   ggua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D15-3p

Accession MIMAT0028188
Sequence

42 - 

cgagcgugggcaagguaccag

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).