Stem-loop sequence mdo-mir-92b

AccessionMI0023776 (change log)
DescriptionMonodelphis domestica miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   -a   a       u            uucuu 
5'   ggg cgggacg ggugcaguguug     u
     ||| ||||||| ||||||||||||      
3'   ucc gcccugc ucacguuauaac     c
   cc   g       -            cgccc 
Get sequence
Deep sequencing
31754 reads, 440 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 189889682-189889743 [+]
sense
ENSMODT00000029451 ; mdo-mir-92b-201; exon 1
Database links

Mature sequence mdo-miR-92b-5p

Accession MIMAT0028518
Sequence

1 - 

agggacgggacguggugcaguguu

 - 24

Get sequence
Deep sequencing81 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-92b-3p

Accession MIMAT0028519
Sequence

41 - 

uauugcacucgucccggccucc

 - 62

Get sequence
Deep sequencing31673 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).