Stem-loop sequence gga-mir-7469

AccessionMI0024142 (change log)
DescriptionGallus gallus miR-7469 stem-loop
Stem-loop
   --            uuu     u   ----     g 
5'   uuugcaaugcaa   uacag aga    ccuua a
     ||||||||||||   ||||| |||    |||||  
3'   aaacguuacguu   guguu ucu    ggagu a
   gg            cgu     -   gaca     g 
Get sequence
Deep sequencing
30 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 18152771-18152837 [+]
sense
ENSGALT00000014910 ; IDS-201; intron 5
Database links

Mature sequence gga-miR-7469-5p

Accession MIMAT0029092
Sequence

1 - 

uuugcaaugcaauuuuacaguag

 - 23

Get sequence
Deep sequencing27 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7469-3p

Accession MIMAT0029093
Sequence

45 - 

uuugugugcuugcauugcaaagg

 - 67

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).