Stem-loop sequence ghr-MIR7484a

AccessionMI0024166 (change log)
DescriptionGossypium hirsutum miR7484a stem-loop
Gene family MIPF0001667; MIR7484
Literature search

1 open access papers mention ghr-MIR7484a
(2 sentences)

Stem-loop
       c                               ca   --a                 a          g  a         cc   uaccu   c    aguacacau    cau 
5' uaaa uaguuuuuguauauuagaucaaagagcaaac  guc   uuuguuaaaaauuucau cauuuuuacu uu aaaacuggu  uua     cag auga         ggca   g
   |||| |||||||||||||||||||||||||||||||  |||   ||||||||||||||||| |||||||||| || |||||||||  |||     ||| ||||         ||||    
3' guuu aucagagacauauaauuuaguuucucguuug  cag   aaacaauuuuuaaggua guaaaaauga aa uuuugacca  aau     guc uacu         ccgu   u
       a                               ac   aaa                 g          a  c         --   uaacu   u    ------gau    uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ghr-miR7484a

Accession MIMAT0029124
Sequence

11 - 

uuuguauauuagaucaaagagcaa

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22138860 "A comparative miRNAome analysis reveals seven fiber initiation-related and 36 novel miRNAs in developing cotton ovules" Wang ZM, Xue W, Dong CJ, Jin LG, Bian SM, Wang C, Wu XY, Liu JY Mol Plant. 5:889-900(2012).