Stem-loop sequence ghr-MIR7484b

AccessionMI0024167 (change log)
DescriptionGossypium hirsutum miR7484b stem-loop
Gene family MIPF0001667; MIR7484
Literature search

1 open access papers mention ghr-MIR7484b
(2 sentences)

Stem-loop
   auuaua          u       c     -   aaug    ------   u  u      uu        cuccuauauaaauuaguaaggguaggucaccaugagguccccagggcauau 
5'       aauuuuugua auuagau aaaga gca    aucc      uug gu aaaauu  caucuauu                                                   c
         |||||||||| ||||||| ||||| |||    ||||      ||| || ||||||  ||||||||                                                    
3'       uuagggauau uaaucua uuucu cgu    uagg      aac ca uuuuaa  guagguaa                                                   a
   aucaaa          u       a     u   ----    uaaaaa   c  u      -c        auaugacuauuuuugacuucacugacccccuuaaccuauuuauuacugugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ghr-miR7484b

Accession MIMAT0029125
Sequence

11 - 

uuuguauauuagaucaaagagcaa

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22138860 "A comparative miRNAome analysis reveals seven fiber initiation-related and 36 novel miRNAs in developing cotton ovules" Wang ZM, Xue W, Dong CJ, Jin LG, Bian SM, Wang C, Wu XY, Liu JY Mol Plant. 5:889-900(2012).