Stem-loop sequence mes-MIR827

AccessionMI0024344 (change log)
DescriptionManihot esculenta miR827 stem-loop
Gene family MIPF0001785; MIR827_4
Literature search

1 open access papers mention mes-MIR827
(1 sentences)

Stem-loop
          a a         a        c   auuu  uu    c 
5' cauggau u uuuguugau gucaucua uca    au  uuaa c
   ||||||| | ||||||||| |||||||| |||    ||  ||||  
3' guacuua a aaacaacua caguagau agu    ua  aauu c
          c c         c        u   --au  uu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold04024: 220009-220098 [+]
intergenic
Database links

Mature sequence mes-miR827

Accession MIMAT0029302
Sequence

62 - 

uuagaugaccaucaacaaaca

 - 82

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).