Stem-loop sequence lja-MIR7531

AccessionMI0024413 (change log)
DescriptionLotus japonicus miR7531 stem-loop
Stem-loop
            c      ca gca                    ca   -   a    a   cuc     c               uuuca 
5' aagguuagu uaaauu  u   ucgguuuccguguuuucuuu  uuc ccc uuuc uuc   ccaau aaacauaacauuaau     a
   ||||||||| ||||||  |   ||||||||||||||||||||  ||| ||| |||| |||   ||||| |||||||||||||||     a
3' uuccaauca auuuaa  a   aguuaaaggcauaaaagaaa  aag ggg aagg aag   gguug uuuguauuguaauua     c
            u      ag agg                    ua   a   a    c   -aa     a               cgaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr2: 8841310-8841488 [-]
intergenic
Database links

Mature sequence lja-miR7531

Accession MIMAT0029354
Sequence

31 - 

cguguuuucuuucauucccca

 - 51

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).