Stem-loop sequence lja-MIR7533a

AccessionMI0024416 (change log)
DescriptionLotus japonicus miR7533a stem-loop
Gene family MIPF0001834; MIR7533
Stem-loop
   u                g                             -                g   ac       cuuggauacauuuaagaagagagagaaaaaaugaauuguauuuaa 
5'  uuggauccucuccauc agcuucucuccauccucucuccauccaaa ucugagccauugauuu gaa  uuaaagg                                             a
    |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |||  |||||||                                             g
3'  aaccuaggagagguag ucgaagagagguaggggagagguagguuu agacucgguaacuaaa cuu  aauuucc                                             g
   a                g                             u                a   aa       acuccuaaucaaguacaaaagagagagaagaauuuaauuaaguuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr4: 2224800-2225045 [+]
intergenic
Database links

Mature sequence lja-miR7533a

Accession MIMAT0029357
Sequence

210 - 

gaggggauggagagaagcugg

 - 230

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).