Stem-loop sequence lja-MIR7533b

AccessionMI0024417 (change log)
DescriptionLotus japonicus miR7533b stem-loop
Gene family MIPF0001834; MIR7533
Stem-loop
   ga         a                                        c    c        ag          u   a         ca  uuuucucucucuucuu   u   uccaagccu 
5'   auuuggauc ucuccauccagcuucucuccauccccucuccauccaaaau ugag cguugauu  gaauuuuaaa gug ggauuaauu  ug                aaa uga         u
     ||||||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||||  |||||||||| ||| |||||||||  ||                ||| |||          
3'   uaaaccuag agagguaggucgaagagagguaggggagagguagguuuua acuc guaauuaa  uuuaaaauuu cac ccuaguuaa  ac                uuu acu         u
   cc         g                                        a    a        aa          c   c         --  --ucuucuuucucuuu   u   uaacauaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr5: 8836063-8836316 [-]
intergenic
Database links

Mature sequence lja-miR7533b

Accession MIMAT0029358
Sequence

215 - 

gaggggauggagagaagcugg

 - 235

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).