Stem-loop sequence ipu-mir-141

AccessionMI0024506 (change log)
DescriptionIctalurus punctatus miR-141 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
       -     u       c    cugu    
5' cauc uuacc gacagug uugg    uca 
   |||| ||||| ||||||| ||||    || c
3' guag aaugg cugucac aauc    agu 
       c     u       -    uugu    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-141

Accession MIMAT0029418
Sequence

39 - 

uaacacugucugguaacgaug

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1