Stem-loop sequence ipu-mir-142-1

AccessionMI0024507 (change log)
DescriptionIctalurus punctatus miR-142-1 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   --          a         uaaacccc 
5'   cauaaaguag aagcacuac        u
     |||||||||| |||||||||         
3'   guauuucauc uuugugaug        c
   ag          c         ugacaccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-142

Accession MIMAT0029419
Sequence

39 - 

guaguguuuccuacuuuaugga

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1